Quantify base editing efficiency for crispressoPooled experiments

usage: crispressoPooled_BE.py [-h] [-j JID] -a AMPLICON_BED -gRNA GRNA_BED -f
                              FASTQ_TSV [--ref REF] [--alt ALT] [--SNP SNP]
                              [-g GENOME] [--genome_fasta GENOME_FASTA]

optional arguments:
  -h, --help            show this help message and exit
  -j JID, --jid JID     enter a job ID, which is used to make a new directory.
                        Every output will be moved into this folder. (default:
                        crispressoPooled_BE_yli11_2020-11-03)
  -a AMPLICON_BED, --amplicon_bed AMPLICON_BED
                        amplicon_bed required (default: None)
  -gRNA GRNA_BED, --gRNA_bed GRNA_BED
                        gRNA_bed required (default: None)
  -f FASTQ_TSV, --fastq_tsv FASTQ_TSV
                        gRNA_bed required (default: None)
  --ref REF             reference base (default: A)
  --alt ALT             alternative base (default: G)
  --SNP SNP             3-col tsv file, gRNA seq, position, SNP (default: )

Genome Info:
  -g GENOME, --genome GENOME
                        genome version: hg19, hg38, mm9, mm10. By default,
                        specifying a genome version will automatically update
                        index file, black list, chrom size and
                        effectiveGenomeSize, unless a user explicitly sets
                        those options. (default: hg19)
  --genome_fasta GENOME_FASTA
                        genome fasta file (default:
                        /home/yli11/Data/Human/hg19/fasta/hg19.fa)

Summary

Code is designed to analyze rhAmp-seq based on crispressoPooled, but should be generic.

Input

The 4th column (name column) in the following two files should match (case sensitive!)

1. Amplicon sequence bed file

The amplicon sequence can be downloaded from IDT. Assay.bed

chr2    57769587        57769832        HBGg22_Target09 0       +
chrX    120721125       120721318       HBGg22_Target122        0       +
chr7    14859651        14859845        HBGg22_Target105        0       +

2. gRNA bed file

Header starting with “#” is acceptable. gRNA bed file should only be spacer sequence, not including the PAM.

#chr    start   end     name    CHANGEseq_reads strand
chr1    171455834       171455854       HBGg22_Target01 1       -
chr1    235564562       235564582       HBGg22_Target02 1       -
chr10   21466883        21466903        HBGg22_Target03 1       +

3. (Optional) SNP input

gRNA seq, position (1-index), actual SNP

GTATATTTGTATTGAGATAG    1       A

Output

For each sample, it outputs a tsv file containing the gRNA name, gRNA sequence, base editing efficiency for each position (only consider the 20bp gRNA length), and ‘indel_frequency’,’total_indel’,’Reads_total’. So totally 25 columns.

file name: $sample_id.edit_eff.tsv

If editing efficiency is -1, meaning no reads mapped to the amplicon sequence.

Usage

Copy fastq files, amplicon bed file, and gRNA bed file in the working dir and run the following:

hpcf_interactive

PATH=/home/yli11/HemTools/bin:/hpcf/lsf/lsf_prod/10.1/linux3.10-glibc2.17-x86_64/etc:/hpcf/lsf/lsf_prod/10.1/linux3.10-glibc2.17-x86_64/bin:/usr/lpp/mmfs/bin:/usr/lpp/mmfs/lib:/usr/local/bin:/usr/bin:/usr/local/sbin:/usr/sbin:/opt/ibutils/bin:/sbin:/cm/local/apps/environment-modules/3.2.10/bin:/opt/puppetlabs/bin
export PATH=$PATH:"/home/yli11/HemTools/bin"


module load python/2.7.13

run_lsf.py --guess_input

crispressoPooled_BE.py -a amp.bed -gRNA gRNA.bed -f fastq.tsv -g hg38 --ref A --alt G

For CBE use:

crispressoPooled_BE.py -a amp.bed -gRNA gRNA.bed -f fastq.tsv -g hg38 --ref C --alt T

For SNP use:

crispressoPooled_BE.py -a amp.bed -gRNA gRNA.bed -f fastq.tsv -g hg38 --ref A --alt G --SNP snp.tsv

code @ github.